Inositol 1,4,5-triphosphate receptor 3 promotes renal cyst development in autosomal dominant polycystic kidney disease / 生理学报

The purpose of the present study was to determine the role of inositol 1,4,5-trisphosphate receptor 3 (IP3R3) in renal cyst development in autosomal dominant polycystic kidney disease (ADPKD). 2-aminoethoxy-diphenyl borate (2-APB) and shRNA were used to suppress the expression of IP3R3. The effect of IP3R3 on cyst growth was investigated in Madin-Darby canine kidney (MDCK) cyst model, embryonic kidney cyst model and kidney specific Pkd1 knockout (PKD) mouse model. The underlying mechanism of IP3R3 in promoting renal cyst development was investigated by Western blot and immunofluorescence staining. The results showed that the expression level of IP3R3 was significantly increased in the kidneys of PKD mice. Inhibiting IP3R3 by 2-APB or shRNA significantly retarded cyst expansion in MDCK cyst model and embryonic kidney cyst model. Western blot and immunofluorescence staining results showed that hyperactivated cAMP-PKA signaling pathway in the growth process of ADPKD cyst promoted the expression of IP3R3, which was accompanied by a subcellular redistribution process in which IP3R3 was translocated from endoplasmic reticulum to intercellular junction. The abnormal expression and subcellular localization of IP3R3 further promoted cyst epithelial cell proliferation by activating MAPK and mTOR signaling pathways and accelerating cell cycle. These results suggest that the expression and subcellular distribution of IP3R3 are involved in promoting renal cyst development, which implies IP3R3 as a potential therapeutic target of ADPKD.

Poliquistosis renal autosómica dominante: ¿quiénes se benefician del tratamiento con tolvaptán?. Estado del arte / Autosomal dominant polycystic kidney disease. Who can benefit from tolvaptan therapy? State of the art / Doença renal policística autossômica dominante: quem se beneficia do tratamento com tolvaptano? Estado da arte

Resumen: La poliquistosis renal autosómica dominante es la enfermedad renal hereditaria más frecuente. Se caracteriza por la progresiva aparición de quistes renales que suelen conducir a la enfermedad renal crónica extrema en la edad adulta. La aprobación del uso de tolvaptán (antagonista del receptor V2 de la vasopresina) ha marcado un cambio significativo en el tratamiento de esta enfermedad. En los últimos años apareció evidencia que demuestra el beneficio en iniciar tratamiento con tolvaptán en pacientes que presentan una enfermedad con rápida evolución. Se realiza una revisión descriptiva de los principales estudios clínicos publicados en el periodo 2012-2022 y se sugiere un esquema de utilidad para seleccionar aquellos pacientes que pueden beneficiarse del inicio de tratamiento.

Abstract: Autosomal dominant polycystic kidney disease is the most common hereditary kidney disease. It is characterized by the progressive appearance of renal cysts that usually lead to extreme chronic kidney disease in adulthood. The approval of the use of tolvaptán (V2 vasopressin receptor antagonist) has meant a significant change in the treatment of this disease. In recent years, evidence has proved the benefits of initiating treatment with tolvaptán in patients with a rapidly evolving disease. A descriptive review of the main clinical studies published in 2012-2022 period is carried out and a useful scheme is suggested to select those patients who can benefit from the start of treatment.

Resumo: A doença renal policística autossômica dominante é a doença renal hereditária mais comum. Caracteriza-se pelo aparecimento progressivo de cistos renais que geralmente levam à doença renal crônica extrema na idade adulta. A aprovação do uso do tolvaptano (antagonista do receptor de vasopressina V2) marcou uma mudança significativa no tratamento dessa doença. Nos últimos anos, surgiram evidências que demonstram o benefício de iniciar o tratamento com tolvaptano em pacientes com doença de evolução rápida. Faz-se uma revisão descritiva dos principais estudos clínicos publicados no período 2012-2022 e sugere-se um esquema útil para selecionar aqueles pacientes que podem se beneficiar do início do tratamento.

Trastornos metabólicos urinarios en pacientes urolitiásicos con enfermedad renal poliquística y sin ella / Urinary metabolic disorders in urolithiasis patients with and without polycystic kidney disease

Introducción: La urolitiasis se ha incrementado en las últimas décadas. La enfermedad renal poliquística autosómica dominante (ERPAD), enfermedad renal hereditaria más frecuente, ocupa un lugar preponderante. Objetivos: Identificar la frecuencia de presentación de los trastornos metabólicos urinarios en pacientes litiásicos cubanos con ERPAD y sin ella Métodos: Estudio descriptivo, transversal. Fueron estudiados 579 pacientes adultos sin ERPAD, seleccionados por muestreo simple aleatorio y los 21 pacientes con ERPAD, del total de pacientes con litiasis urinaria que se realizó estudio metabólico renal en el Laboratorio de Fisiopatología Renal del Instituto de Nefrología, en el periodo 2010-2015. Los datos fueron tomados de la historia clínica y del informe de estudio metabólico renal. La información se procesó de forma automatizada (SPSS 22.0). Se utilizó el promedio, desviación estándar, análisis de distribución de frecuencias y el test de homogeneidad. Resultados: En los pacientes con ERPAD predominó el sexo femenino (57,1 por ciento), mientras que en los pacientes sin ERPAD, el masculino (63,4 por ciento). Los trastornos más frecuentes en la población no poliquística fueron hipercalciuria (45,3 por ciento) e hipofosfatemia (17,1 por ciento). En los poliquísticos, aclaramiento aumentado de ácido úrico (38,1 por ciento) e hipercalciuria (23,8 por ciento). Se encontraron diferencias estadísticamente significativas para aumento del aclaramiento de ácido úrico (p = 0,01) e hiperfosfatemia (p = 0,04). Conclusiones: Los principales trastornos metabólicos de los pacientes litiásicos, tanto poliquísticos como no poliquísticos, son el aclaramiento de ácido úrico aumentado, hipercalciuria, hiperuricosuria e hipofosfatemia, aunque el orden de presentación es diferente. El aclaramiento de ácido úrico aumentado y la hiperfosfatemia se presentan con mayor frecuencia en los pacientes litiásicos poliquísticos(AU)

Introduction: Urolithiasis has increased in recent decades. Autosomal dominant polycystic kidney disease (ADPKD), the most common of all hereditary kidney diseases, occupies a predominant position in terms of incidence. Objectives: Identify the frequency of occurrence of urinary metabolic disorders in Cuban urolithiasis patients with and without ADPKD. Methods: A descriptive cross-sectional study was conducted of 579 adult patients without ADPKD selected by simple random sampling, and 21 patients with ADPKD, from the total urolithiasis patients undergoing renal metabolic evaluation at the Renal Physiopathology Laboratory of the Institute of Nephrology in the period 2010-2015. Data were obtained from medical records and reports of renal metabolic studies. Information was processed with the statistical software SPSS version 22.0. Average and standard deviation were estimated and use was made of frequency distribution analysis and homogeneity testing. Results: A predominance was found of female sex among patients with ADPKD (57.1 percent) and male sex among patients without ADPKD (63.4 percent). The most common disorders were hypercalciuria (45.3 percent) and hypophosphatemia (17.1 percent) in the non-polycystic population, and increased uric acid clearance (38.1 percent) and hypercalciuria (23.8 percent) in polycystic patients. Statistically significant differences were found in uric acid clearance increase (p = 0.01) and hyperphosphatemia (p = 0.04). Conclusions: The main metabolic disorders of lithiasis patients, polycystic as well as non-polycystic, are increased uric acid clearance, hypercalciuria, hyperuricosuria and hypophosphatemia, with a varying order of presentation. Increased uric acid clearance and hyperphosphatemia are more common in polycystic lithiasis patients(AU)

Prevalence of autosomal dominant polycystic kidney disease in Persian and Persian-related cats in Brazil / Prevalência da doença renal policística autossômica dominante em gatos Persas e raças relacionadas no Brasil

Autosomal dominant polycystic kidney disease (ADPKD) is the most common genetic disease in cats. However, scarce data on its prevalence are available in Brazil. Persian cats and Persian-related breeds were assessed by molecular genotyping for a C to A transversion in exon 29 of PKD1 gene to determine ADPKD prevalence in a Brazilian population. Genomic DNA extracted from peripheral whole blood or oral swabs samples was used to amplify exon 29 of PKD1 gene employing a PCR-RFLP methodology. From a total of 616 animals, 27/537 Persian and 1/17 Himalayan cats showed the single-nucleotide variant (C to A) at position 3284 in exon 29 of feline PKD1. This pathogenic variation has been identified only in heterozygous state. The prevalence of ADPKD in Persian cats and Persian-related breeds was 5.03% and 1.6%, respectively. There was no significant association between feline breed, gender or age with ADPKD prevalence. Of note, the observed ADPKD prevalence in Persian cats and Persian-related breeds in Brazil was lower than the ones reported in other parts of the world. This finding may be related to genetic counseling and consequent selection of ADPKD-free cats for reproduction.

A doença renal policística autossômica dominante (DRPAD) é a doença genética mais comum em gatos. No entanto, poucos dados sobre sua prevalência estão disponíveis no Brasil. Gatos Persas e de raças relacionadas foram avaliados por genotipagem molecular para a transversão C→A no exon 29 do gene PKD1 felino para determinar a prevalência de DRPAD. DNA genômico extraído de sangue total periférico ou amostras de swabs orais foram utilizados para amplificar o exon 29 do gene PKD1 pela técnica de PCR-RFLP. De um total de 616 gatos, 27/537 Persas e 1/17 Himalaia mostraram a variante de nucleotídeo único (C→A) na posição 3284 no exon 29 do gene PKD1. Esta variante patogênica foi identificada apenas em heterozigose. A prevalência de DRPAD em gatos Persas e raças relacionadas foram de 5,03% e 1,6%, respectivamente. Não houve associações significativas entre raça, gênero ou idade dos felinos e incidência de DRPAD. A prevalência de DRPAD em gatos Persas e raças relacionadas no Brasil foi menor do que em outras partes do mundo, o que pode estar relacionado ao aconselhamento genético e consequente seleção de gatos sem ADPKD para reprodução.

Analysis of PKD2 gene variant and protein localization in a pedigree affected with polycystic kidney disease / 中华医学遗传学杂志

OBJECTIVE@#To detect the mutation site in a pedigree affected with autosomal dominant polycystic kidney disease (ADPKD) and verify its impact on the protein function.@*METHODS@#Peripheral blood samples were collected from the proband and his pedigree members for the extraction of genomic DNA. Mutational analysis was performed on the proband through whole-exome sequencing. Suspected variant was verified by Sanger sequencing. A series of molecular methods including PCR amplification, restriction enzyme digestion, ligation and transformation were also used to construct wild-type and mutant eukaryotic expression vectors of the PKD2 gene, which were transfected into HEK293T and HeLa cells for the observation of protein expression and cell localization.@*RESULTS@#The proband was found to harbor a c.2051dupA (p. Tyr684Ter) frame shift mutation of the PKD2 gene, which caused repeat of the 2051st nucleotide of its cDNA sequence and a truncated protein. Immunofluorescence experiment showed that the localization of the mutant protein within the cell was altered compared with the wild-type, which may be due to deletion of the C-terminus of the PKD2 gene.@*CONCLUSION@#The c.2051dupA (p. Tyr684Ter) mutation of the PKD2 gene probably underlay the pathogenesis of ADPKD in this pedigree.

Chronic brucellosis with hepatic brucelloma and AA amyloidosis in a patient with autosomal dominant polycystic kidney disease

We describe an autopsy case of a 45-year-old male diagnosed with autosomal dominant polycystic kidney disease who presented with complaints of altered sensorium. The autopsy revealed multiple tumor-like masses in the liver, which on histological examination depicted multiple large suppurative granulomas with the presence of variable acid-fast coccobacilli (consistent with Brucella spp.). Interestingly, extensive amyloid deposition in multiple organs was noted. To the best of our knowledge, this is the first case of chronic brucellosis causing tumor-like abscesses in the liver accompanied by secondary systemic amyloidosis in a patient with underlying autosomal dominant polycystic kidney disease.

Application of immunosuppressants in patients with autosomal dominant polycystic kidney disease after kidney transplantation / 南方医科大学学报

OBJECTIVE@#To investigate the optimal dose range of immunosuppressants in patients with autosomal dominant polycystic kidney disease (ADPKD) after renal transplantation.@*METHODS@#A cohort of 68 patients with ADPKD who received their first renal transplantation between March, 2000 and January, 2018 in our institute were retrospectively analyzed, with 68 non-ADPKD renal transplant recipients matched for gender, age and date of transplant as the control group. We analyzed the differences in patient and renal survival rates, postoperative complications and concentrations of immunosuppressive agents between the two groups at different time points within 1 year after kidney transplantation. The concentrations of the immunosuppressants were also compared between the ADPKD patients with urinary tract infections (UTI) and those without UTI after the transplantation.@*RESULTS@#The recipients with ADPKD and the control recipients showed no significantly difference in the overall 1-, 5-, and 10- year patient survival rates (96.6% 96.0%, 94.1% 93.9%, and 90.6% 93.9%, respectively; > 0.05), 1-, 5-, and 10-year graft survival rates (95.2% 96.0%, 90.8% 87.2%, and 79.0% 82.3%, respectively; > 0.05), or the incidences of other post- transplant complications including acute rejection, gastrointestinal symptoms, cardiovascular events, pneumonia, and neoplasms ( > 0.05). The plasma concentrations of both tacrolimus and mycophenolate mofetil (MPA) in ADPKD group were significantly lower than those in the control group at 9 months after operation ( < 0.05). The incidence of UTI was significantly higher in ADPKD patients than in the control group ( < 0.05). In patients with ADPKD, those with UTI after transplantation had a significantly higher MPA plasma concentration ( < 0.05).@*CONCLUSIONS@#In patients with ADPKD after renal transplant, a higher dose of MPA is associated with a increased risk of UTI, and their plasma concentrations of immunosuppressants for long-term maintenance of immunosuppression regimen can be lower than those in other kidney transplantation recipients.

Ultrasonographic manifestation and genetic analysis of a fetus with nephronophthisis type 2 / 中华医学遗传学杂志

OBJECTIVE@#To carry out genetic analysis for a family with a fetus manifesting bilateral polycystic renal dysplasia and oligohydramnios at 16 gestational week and a previous history for fetal renal anomaly.@*METHODS@#Ultrasound scan was carried out to detect the morphological changes. Following genetic counselling, the parents had decided to terminate the pregnancy. Fetal kidneys were subjected to histological examination. Target capture and next generation sequencing (NGS) was applied to the abortus to detect potential variants. The results were verified by Sanger sequencing.@*RESULTS@#Histological examination of fetal kidneys revealed cystic changes without cortex, medulla or normal renal structure. NGS has identified a heterozygous c.100+1G>A variant and deletion of exon 3 of the INVS gene, which were respectively inherited from the mother and father.@*CONCLUSION@#Through NGS and Sanger sequencing, the fetus was diagnosed with type II nephronophthisis (NPHP2). Above result can provide guidance for further pregnancy and enforce understanding of clinical features and genetic etiologies for NPHP.

Refractory ascites and graft dysfunction in early renal transplantation / Ascite refratária e disfunção do enxerto no pós-transplante renal precoce

Abstract The occurrence of ascites after Renal Transplant (RT) is infrequent, and may be a consequence of surgical or medical complications. Case report: 61 year-old, male, history of arterial hypertension, tongue carcinoma and alcoholic habits 12-20g/day. He had chronic kidney disease secondary to autosomal dominant polycystic kidney disease, without hepatic polycystic disease. He underwent cadaver donor RT in September 2017. He had delayed graft function by surgically corrected renal artery stenosis. He was admitted in January 2018 for ascites de novo, with no response to diuretics. HE had visible abdominal collateral circulation. Graft dysfunction, adequate tacrolinemia, Innocent urinary sediment, mild anemia, without thrombocytopenia. Serum albumin 4.0g / dL. Normal hepatic biochemistry. Peritoneal fluid with transudate characteristics and serum albumin gradient > 1.1. Ultrasound showed hepatomegaly, permeable vascular axes, without splenomegaly. Mycophenolate mofetil was suspended, with reduced remaining immunosuppression. He maintained refractory ascites: excluded infectious, metabolic, autoimmune and neoplastic etiologies. No nephrotic proteinuria and no heart failure. MRI: micronodules compatible with bile cysts. Upper Digestive Tract Endoscopy did not show gastroesophageal varicose veins. Normal abdominal lymphoscintigraphy. He underwent exploratory laparoscopy with liver biopsy: incomplete septal cirrhosis of probable vascular etiology some dilated bile ducts. He maintained progressive RT dysfunction and restarted hemodialysis. The proposed direct measurement of portal pressure was delayed by ascites resolution. There was further recovery of the graft function. Discussion: Incomplete septal cirrhosis is an uncommon cause of non-cirrhotic portal hypertension. Its definition is not well known, morphological and pathophysiological. We have not found published cases of post-RT ascites secondary to this pathology, described as possibly associated with drugs, immune alterations, infections, hypercoagulability and genetic predisposition.

Resumo A ocorrência de ascite no pós-Transplante Renal (TR) é infrequente, podendo ser consequência de complicações cirúrgicas ou médicas. Caso clínico: 61 anos, masculino, antecedentes de hipertensão arterial, carcinoma da língua e hábitos alcoólicos 12-20g/dia. Doença renal crônica secundária à doença renal poliquística autossômica dominante, sem poliquistose hepática. Submetido a TR de doador cadáver em setembro de 2017. Atraso na função de enxerto por estenose da artéria renal, corrigida cirurgicamente. Internado em janeiro de 2018 por ascite de novo, sem resposta a diuréticos. Circulação colateral abdominal visível. Disfunção do enxerto, tacrolinemia adequada. Sedimento urinário inocente. Anemia ligeira, sem trombocitopenia. Albumina sérica 4,0g/dL. Bioquímica hepática normal. Líquido peritoneal com características de transudado e gradiente sero-ascítico de albumina > 1,1. Ecografia com hepatomegalia, eixos vasculares permeáveis, sem esplenomegalia. Suspendeu micofenolato mofetil, reduziu restante imunossupressão. Manteve ascite refratária: excluídas etiologias infecciosas, metabólicas, autoimunes e neoplásicas. Sem proteinúria nefrótica e sem insuficiência cardíaca. RM: micronódulos compatíveis com quistos biliares. EDA sem varizes gastroesofágicas. Linfocintigrafia abdominal normal. Submetido a laparoscopia exploradora com biópsia hepática: cirrose septal incompleta de provável etiologia vascular, alguns ductos biliares dilatados. Manteve disfunção progressiva do TR, reiniciou hemodiálise. Proposta medição direta da pressão portal, protelada por resolução da ascite. Recuperação posterior da função de enxerto. Discussão: A cirrose septal incompleta é uma causa incomum de hipertensão portal não cirrótica. A sua definição é morfológica e a fisiopatologia, pouco conhecida. Não encontramos publicados casos de ascite pós-TR secundária a esta patologia, descrita como possivelmente associada a fármacos, alterações imunitárias, infecções, hipercoagulabilidade e predisposição genética.

Genetic diagnosis and prenatal diagnosis of autosomal dominant polycystic kidney disease / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).@*METHODS@#Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.@*RESULTS@#Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.@*CONCLUSION@#Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.

Research progress in autosomal dominant polycystic kidney disease / 中南大学学报(医学版)

Autosomal dominant polycystic kidney disease (ADPKD) is a common hereditary disease, mainly caused by polycystic kidney disease 1/2 (PKD1/2) gene mutation. The main manifestation is the formation of multiple progressive enlarged cysts in both kidneys, which can be accompanied by decreased glomerular filtration rate, hypertension, liver cyst and cerebral aneurysm. About 45% of patients will progress to end-stage renal failure before the age of 60. ADPKD gene sequencing can be chosen for suspicious patients with atypical clinical features, no positive family history, and inconspicuous imaging findings. In the ADPKD positive families, imaging examination is the main means of diagnosing ADPKD. Height-adjusted total kidney volume (htTKV) and kidney growth rate are commonly used to monitor ADPKD disease progression and prognosis. There is no effective treatment for ADPKD to stop its progress. Drugs such as tolvaptan and bosutinib can delay the renal disfunction and they have been applied to clinical therapy in Europe and America.

Obturator hernia in autosomal dominant polycystic kidney disease

No abstract available.

Long-term Tolvaptan Treatment of Autosomal Dominant Polycystic Kidney Disease in Korea

A 22-year-old male patient was diagnosed with autosomal dominant polycystic kidney disease (ADPKD). He received conservative treatment with an angiotensin-converting enzyme inhibitor. Two years later, oral therapy, consisting of 60 mg tolvaptan per day, was initiated. Compared with height-adjusted total kidney volume, the rate of kidney growth reduced significantly from 7.33% to 0.66% annually, since commencement of the tolvaptan therapy. The liver enzyme profile and serum sodium level and osmolality were constantly within normal ranges. In Korea, this is the first reported case of a patient with ADPKD who received tolvaptan treatment for more than 1 year. This case demonstrates that long-term tolvaptan treatment appears to be safe, well tolerated, and effective for ADPKD.

Identification of a novel UMOD mutation (c. 163G>A) in a Brazilian family with autosomal dominant tubulointerstitial kidney disease

Autosomal dominant tubulointerstitial kidney disease (ADTKD) is characterized by autosomal dominant inheritance, progressive chronic kidney disease, and a bland urinary sediment. ADTKD is most commonly caused by mutations in the UMOD gene encoding uromodulin (ADTKD-UMOD). We herein report the first confirmed case of a multi-generational Brazilian family with ADTKD-UMOD, caused by a novel heterozygous mutation (c.163G>A, GGC→AGC, p.Gly55Ser) in the UMOD gene. Of 41 family members, 22 underwent genetic analysis, with 11 individuals found to have this mutation. Three affected individuals underwent hemodialysis, one peritoneal dialysis, and one patient received a kidney transplant from a family member later found to be genetically affected. Several younger individuals affected with the mutation were also identified. Clinical characteristics included a bland urinary sediment in all tested individuals and a kidney biopsy in one individual showing tubulointerstitial fibrosis. Unlike most other reported families with ADTKD-UMOD, neither gout nor hyperuricemia was found in affected individuals. In summary, we report a novel UMOD mutation in a Brazilian family with 11 affected members, and we discuss the importance of performing genetic testing in families with inherited kidney disease of unknown cause.

Preimplantation genetic diagnosis for infertile males with autosomal dominant polycystic kidney disease / 中华男科学杂志

<p><b>Objective</b>Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common genetic renal diseases, which may cause oligoasthenospermia and azoospermia and result in male infertility. This study aimed to analyze the outcomes of preimplantation genetic diagnosis (PGD) in male patients with ADPKD-induced infertility.</p><p><b>METHODS</b>We retrospectively analyzed the clinical data on 7 male patients with ADPKD-induced infertility undergoing PGD from April 2015 to February 2017, including 6 cases of oligoasthenospermia and 1 case of obstructive azoospermia, all with the PKD1 gene heterozygous mutations. Following intracytoplasmic sperm injection (ICSI), we performed blastomere biopsy after 5 or 6 days of embryo culture and subjected the blastomeres to Sureplex whole-genome amplification, followed by haplotype linkage analysis, Sanger sequencing, array-based comparative genomic hybridization to assess the chromosomal ploidy of the unaffected embryos, and identification of the unaffected euploid embryos for transfer.</p><p><b>RESULTS</b>One PGD cycle was completed for each of the 7 patients. Totally, 26 blastocysts were developed, of which 12 were unaffected and diploid. Clinical pregnancies were achieved in 6 cases following 7 cycles of frozen embryo transplantation, which included 5 live births and 1 spontaneous abortion.</p><p><b>CONCLUSIONS</b>For males with ADPKD-induced infertility, PGD may contribute to high rates of clinical pregnancy and live birth and prevent ADPKD in the offspring as well. This finding is also meaningful for the ADPKD patients with normal fertility.</p>

Novel Experience of Contrast-Enhanced Ultrasonography to Differentiate Between Renal Cysts and Renal Cell Carcinoma

We report our first experience with the use of contrast-enhanced ultrasonography (CEUS) to differentiate between a complicated hemorrhagic renal cyst and a cystic renal cell carcinoma in a 50-year-old man diagnosed with autosomal dominant polycystic kidney disease undergoing hemodialysis for end-stage renal disease. CEUS could successfully differentiate between a complicated hemorrhagic renal cyst and a cystic renal cell carcinoma, as opposed to computed tomography (CT) or magnetic resonance imaging (MRI), which could not distinguish between the 2 disease conditions. CEUS is comparable diagnostic tool as CT or MRI to distinguish between benign and malignant cystic renal masses.

Autosomal Dominant Polycystic Kidney Desease Coexisting with Renal Dysplasia. First Case Described and Followed Since Prenatal Period

Autosomal dominant polycystic kidney disease (ADPKD) is the most frequent hereditary renal disease and causes terminal chronic renal failure. ADPKD is characterized by bilateral multiple renal cysts, which are produced by mutations of the PKD1 and PKD2 genes. PKD1 is located on chromosome 16 and encodes a protein that is involved in cell cycle regulation and intracellular calcium transport in epithelial cells and is responsible for 85% of ADPKD cases. Although nine cases of unilateral ADPKD with contralateral kidney agenesis have been reported, there have been no reports of early childhood ADPKD. Here, we report the only case of unilateral ADPKD with contralateral kidney dysplasia in the world in a four year-old girl who was intrauterinely diagnosed since she was 20 weeks old and followed for four years until present.

Autosomal Dominant Polycystic Kidney Desease Coexisting with Renal Dysplasia. First Case Described and Followed Since Prenatal Period

Autosomal dominant polycystic kidney disease (ADPKD) is the most frequent hereditary renal disease and causes terminal chronic renal failure. ADPKD is characterized by bilateral multiple renal cysts, which are produced by mutations of the PKD1 and PKD2 genes. PKD1 is located on chromosome 16 and encodes a protein that is involved in cell cycle regulation and intracellular calcium transport in epithelial cells and is responsible for 85% of ADPKD cases. Although nine cases of unilateral ADPKD with contralateral kidney agenesis have been reported, there have been no reports of early childhood ADPKD. Here, we report the only case of unilateral ADPKD with contralateral kidney dysplasia in the world in a four year-old girl who was intrauterinely diagnosed since she was 20 weeks old and followed for four years until present.

Femoral Neuropathy Secondary to Autosomal Dominant Polycystic Kidney Disease: A Case Report

Compressive femoral neuropathy is a disabling condition accompanied by difficulty in hip flexion and knee extension. It may result from retroperitoneal hematoma or bleeding, or from complications associated with pelvic, hip surgery, and renal transplants. A 55-year-old female with autosomal dominant polycystic kidney disease presented with proximal muscle weakness in lower extremities. The patient experienced recurrent renal cyst infection, with aggravated weakness during each event. Electromyography and nerve conduction study revealed bilateral femoral neuropathy. Computed tomography and magnetic resonance images were added to further identify the cause. As a result, a diagnosis of femoral neuropathy caused by enlarged polycystic kidney was made. Cyst infection was managed with antibiotics. Renal function was maintained by frequent regular hemodialysis. While avoiding activities that may increase abdominal pressure, rehabilitation exercises were provided. Motor strength in hip flexion and knee extension improved, and was confirmed via electrodiagnostic studies.